website:  https://zenodo.org/records/8409239


rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database
Creators

    Zachary Gold1
    ORCID icon
    Emily Curd2
    ORCID icon
    Luna Gal3
    Ramon Gallego4
    Shaun Nielsen5
    Katherine Silliman6

Description

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 .

Primer Name:  MiFish Universal
Gene:   12S
Length of Target:    163–185
get_seeds_local() minimum length:    170
get_seeds_local() maximum length:    250
blast_seeds() minimum length:    140
blast_seeds() maximum length:    250
max_to_blast:  1000
Forward Sequence (5'-3'):   GTGTCGGTAAAACTCGTGCCAGC
Reverse Sequence (5'-3'):    CATAGTGGGGTATCTAATCCCAGTTTG
Reference:    Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. https://doi.org/10.1098/rsos.150088

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.  
